LentiWeb siRNA Database
HIV
LentiWeb.com
Home Forum Chat Links

Lentiweb siRNA Database

Lentiweb siRNA Database

We are crating a database of working siRNA sequences. Here are few examples collected from published papers and some received from our collaborators. If you identified or published good siRNA sequence and would like to share it with others, please email it to us and we will post it here (including your email address or paper references as acknowledgements).

Please consult Tronolab Lentivectors, Cloning Strategies or recent publication for informations how to design expression vector with siRNA (shRNA).

Maciej Wiznerowicz

Name Species Sequence References
CD4 human GATCAAGAGACTCCTCAGTGA Audino
CD4 mouse GCTACAACTACTACATGAC Nat Genet. 33:401, 2003
CD25 mouse GCATTCACCTAATCGGCTG Nat Genet. 33:401, 2003
CDH1 human GACTCCAGTGGTAATCTAC Science 296:553, 2002
GFP ??? GAACGGCATCAAGGTGAAC Fred Iseni; Univ. of Geneva
K-Ras human GTTGGAGCTGTTGGCGTAG Cancer Cell 2:243, 2002
Lamin A/C human CTGGACTTCCAGAAGAACA Nature Biotech 20:505, 2002
Lamin B1 human CGCGCTTGGTAGAGGTGGATT Nature 411:494, 2001
p53 human GACTCCAGTGGTAATCTAC Science 296:553, 2002
p53 mouse GTACATGTGTAATAGCTCC J. Biol. Chem. 278:11731, 2003
p65 mouse GAGTTTCAGCAGCTCCTGAAC PNAS 101:7347 2004
ELKS human ATGCTGCCTATGCCACCTC Science 304:1963, 2004